View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1948_low_24 (Length: 225)
Name: NF1948_low_24
Description: NF1948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1948_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 4 - 211
Target Start/End: Original strand, 43210404 - 43210611
Alignment:
| Q |
4 |
atgatgtagttggggttaaaaatacgatttgttggagaaatannnnnnngtattgtccgaggtaatgaggagagtggagggagatggttagttgttaacg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
43210404 |
atgatgtagttggggttaaaaatacgatttgttggagaaatatttttttgtattgtccgaggtaatgaggagagtggagggagatggtttgttggtaacg |
43210503 |
T |
 |
| Q |
104 |
ttactaaaacggtagagagtagtagtaccacattattttggcatgaaccatggttgggtgatgaggttttaaaggagtgctttaatgtgctttgagaaaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43210504 |
ttactaaaacggtagagagtagtagtaccacattattttggcatgaaccatggttgggtgatgaggttttaaaggagtgctttaatgtgctttgagaaaa |
43210603 |
T |
 |
| Q |
204 |
gaagaaga |
211 |
Q |
| |
|
|||||||| |
|
|
| T |
43210604 |
gaagaaga |
43210611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 112
Target Start/End: Original strand, 21462425 - 21462469
Alignment:
| Q |
68 |
atgaggagagtggagggagatggttagttgttaacgttactaaaa |
112 |
Q |
| |
|
||||||||||||||||||||||||| || | ||| |||||||||| |
|
|
| T |
21462425 |
atgaggagagtggagggagatggtttgtggataatgttactaaaa |
21462469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University