View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19490_high_18 (Length: 294)
Name: NF19490_high_18
Description: NF19490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19490_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 247 - 279
Target Start/End: Complemental strand, 10780462 - 10780430
Alignment:
| Q |
247 |
tgtgttgatattaactaatactttctttttaat |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10780462 |
tgtgttgatattaactaatactttctttttaat |
10780430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 172 - 225
Target Start/End: Original strand, 25435716 - 25435769
Alignment:
| Q |
172 |
gacacattttccaacacataatttttatttttggtaccttaacatgtgccctaa |
225 |
Q |
| |
|
|||||| ||| |||| |||||||| ||| |||| |||||||||||||||||||| |
|
|
| T |
25435716 |
gacacaattttcaacgcataatttctatctttgataccttaacatgtgccctaa |
25435769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University