View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19490_high_23 (Length: 261)
Name: NF19490_high_23
Description: NF19490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19490_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 12 - 247
Target Start/End: Original strand, 710139 - 710374
Alignment:
| Q |
12 |
cagagatatcaaatttgctactgcttcttgatgaagttgatgaactactccttctgctcataatccttttgagagatgatgccatttctgctgcaccttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
710139 |
cagagatatcaaatttgctactgcttcttgatgaagttgatgaactactccttctgctcataatccttttgagagatgatgccatttctgctgcaccttt |
710238 |
T |
|
| Q |
112 |
tcgacttgcactcctcgataatgaggtcggtgttgtgcatcttctgcttccttgtcttgatagaggccttgttcttggatttggagtttttgatcttcta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
710239 |
tcgacttgcactcctcgataatgaggtcggtgttgtgcatcttctgcttccttgtcttgatagaggccttgttcttggatttggagtttttgatcttcta |
710338 |
T |
|
| Q |
212 |
ctttcaattcttgcaattaatttagggctccaaatg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
710339 |
ctttcaattcttgcaattaatttagggctccaaatg |
710374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University