View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19490_high_26 (Length: 246)
Name: NF19490_high_26
Description: NF19490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19490_high_26 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 246
Target Start/End: Original strand, 37996523 - 37996757
Alignment:
| Q |
18 |
agatggggatcataatgataaccattagcatatcctacaaacactgtacagtatttgtttatgagccaagtaatttaatgttttgttatcacatgtttat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37996523 |
agatggggatcataatgataaccattagcatatcctacaaacactgtacagtatttgtttatgagccaagtaatttaatgttttgttatcacatgtttat |
37996622 |
T |
 |
| Q |
118 |
------ctgaatcgattctgtctagctagtagcatttccatcttaggcaacaaaagtctttaacttcttctcaactacttgagcttattagactctagaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37996623 |
aattatctgaatcgattctgtctagctagtagcatttccatcttaggcaacaaaagtctttaacttcttctcaactacttgagcttattagactctagaa |
37996722 |
T |
 |
| Q |
212 |
aaaccttcattgagtatcaagacagtgacagaata |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
37996723 |
aaaccttcattgagtatcaagacagtgaaagaata |
37996757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University