View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19490_low_9 (Length: 414)
Name: NF19490_low_9
Description: NF19490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19490_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 7972380 - 7972160
Alignment:
| Q |
19 |
ctttgagtgtttgtaaaatagaaaaactttgttaccaaaggcatagaattt-atctaaaacacttgtaaactaatccaattatcaaacttataagttaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7972380 |
ctttgagtgtttgtaaaatagaaaaactttgttaccaaaggcatagaattttatctaaaacaattgtaaactaatccaattatcaaacttataaattaat |
7972281 |
T |
 |
| Q |
118 |
tctttatatttacagaaaagcaaatatcaaggatttctgcttggatatttgttgatttatgaattagttccttgaggtaagtttattcattttgtgtgcg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7972280 |
tctttatatttacagaaaagcaaatatcaaggatttctgcttggatatttgttgatttatgaattagttccttgaggtaagtttattcattt--tgtgcg |
7972183 |
T |
 |
| Q |
218 |
gtgtcttggttgtatctcataat |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7972182 |
gtgtcttggttgtatctcataat |
7972160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University