View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19493_high_21 (Length: 235)
Name: NF19493_high_21
Description: NF19493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19493_high_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 178 - 221
Target Start/End: Original strand, 34953017 - 34953060
Alignment:
| Q |
178 |
tagaataaaagggcctttttggccacatcatgatatgaccaagt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34953017 |
tagaataaaagggcctttttggccacatcatgatatgaccaagt |
34953060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University