View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19493_high_21 (Length: 235)

Name: NF19493_high_21
Description: NF19493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19493_high_21
NF19493_high_21
[»] chr6 (1 HSPs)
chr6 (178-221)||(34953017-34953060)


Alignment Details
Target: chr6 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 178 - 221
Target Start/End: Original strand, 34953017 - 34953060
Alignment:
178 tagaataaaagggcctttttggccacatcatgatatgaccaagt 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
34953017 tagaataaaagggcctttttggccacatcatgatatgaccaagt 34953060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University