View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19493_low_15 (Length: 350)
Name: NF19493_low_15
Description: NF19493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19493_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 24 - 332
Target Start/End: Complemental strand, 42728223 - 42727930
Alignment:
| Q |
24 |
ttctccacgacatatggtatcatatgcaatagaccgcaaacagattattttaacgaggtaattttatcttaacaattgttctgtttccattaactttata |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42728223 |
ttctccacgacatatggtatcatatgcaatagaccgcaaacagat--------------aattttatcttaacaattgttctatttccattaactttata |
42728138 |
T |
|
| Q |
124 |
ttcaccaacttttttcattttatttgttcagcatactttttcgaaagaagtgaaggatgtgctacagaatgatttaatcaatggagacaacaataggttt |
223 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42728137 |
ttcactaacttttttcattttatttgttcagcatactttttcgaaagaagtgaaggatgtgctatagaatgatttaatcaatggagacaacaataggttt |
42728038 |
T |
|
| Q |
224 |
tggcaacataggatttacatagaaaggcttccggtttagatcaagaaatattccatatgatnnnnnnntatatcaaaacccaactagcagaggtaatgaa |
323 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42728037 |
tggcaacatgggatttacatagaaaggcttccggtttagatcaagaaatattccatatgat-aaaaaatatatcaaaacccaactagcagaggtaatgaa |
42727939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University