View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19493_low_20 (Length: 236)
Name: NF19493_low_20
Description: NF19493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19493_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 115 - 219
Target Start/End: Complemental strand, 1798690 - 1798586
Alignment:
| Q |
115 |
aatgaaagaataaatcattgtttagttgtatcagaataattacacggggtcatcatgaaaaatattcatggtcccatctcccatcattagttattcccta |
214 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1798690 |
aatgaaagaataaatcattctttagttgtatcagaataattacacggggtcatcatgaaaaatattcatggtcccatctcccatcattagttattcccta |
1798591 |
T |
 |
| Q |
215 |
attcg |
219 |
Q |
| |
|
||||| |
|
|
| T |
1798590 |
attcg |
1798586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University