View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19494_high_26 (Length: 261)

Name: NF19494_high_26
Description: NF19494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19494_high_26
NF19494_high_26
[»] chr2 (2 HSPs)
chr2 (48-189)||(39460982-39461123)
chr2 (196-224)||(39461158-39461186)


Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 48 - 189
Target Start/End: Original strand, 39460982 - 39461123
Alignment:
48 caatgtcaggtttgcaacacataggtcgatgatgaatgaggaaaatatcgaattcaataacgactatgtgtgacagatttgacattgcgaaaaattcatt 147  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
39460982 caatgtcaggtttgcaacacataggtcgatgatgaatgaggaaaatatcgaattcaataacgactatgtgtgacagatttgacattgccaaaaattcatt 39461081  T
148 tgggatagtgcaaggctgacaaaaactttacagtggaagact 189  Q
    ||||||||||||||||||||||||||||||||||||||||||    
39461082 tgggatagtgcaaggctgacaaaaactttacagtggaagact 39461123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 196 - 224
Target Start/End: Original strand, 39461158 - 39461186
Alignment:
196 aaaaatcgaagcttaaaaacccaattcac 224  Q
    |||||||||||||||||||||||||||||    
39461158 aaaaatcgaagcttaaaaacccaattcac 39461186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University