View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19494_high_29 (Length: 247)

Name: NF19494_high_29
Description: NF19494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19494_high_29
NF19494_high_29
[»] chr4 (3 HSPs)
chr4 (1-100)||(47741668-47741767)
chr4 (157-232)||(47741485-47741560)
chr4 (120-157)||(47741611-47741648)


Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 47741767 - 47741668
Alignment:
Q  1 tcagatttcaaatttttaacttataagaaataaataagtaatttaatttcttatcttatactttcaaattaaattcaggataatgattttagctagaaag 100  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  47741767 tcagatttcaaatttttaacttataaggaataaataagtaatttaatttgttatcttatactttcaaattaaattcaggataatgattttaactagaaag 47741668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 157 - 232
Target Start/End: Complemental strand, 47741560 - 47741485
Alignment:
Q  157 atatcagattatctcatcaaacattaaattgaaataaaatatgatagaattatattggctacctaatagaccatta 232  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  47741560 atatcagattatctcatcaaacattaaattgaaataaaatatgatagaattatattggcaacctaatagaccatta 47741485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 120 - 157
Target Start/End: Complemental strand, 47741648 - 47741611
Alignment:
Q  120 taaatatttagattcaagtggttaatgacgagaaccga 157  Q
    ||||||||||||||||||||||||||||||||||||||    
T  47741648 taaatatttagattcaagtggttaatgacgagaaccga 47741611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University