View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19494_high_30 (Length: 241)
Name: NF19494_high_30
Description: NF19494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19494_high_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 16 - 151
Target Start/End: Complemental strand, 12830545 - 12830410
Alignment:
| Q |
16 |
attatacttgtcacttttattcattaatatttgtaagaattttgtccttttattctattaacttgcaacataatcattttcggttttagtgatattaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12830545 |
attatacttgtcacttttattcattaatatttgtaagaattttgtccttttattctattaacttgcaaaataatcattttcggttttagtgatattaaat |
12830446 |
T |
|
| Q |
116 |
ttgtagtgttcatattagtgatacttgcctcaaggt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
12830445 |
ttgtagtgttcatattagtgatacttgcctcaaggt |
12830410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University