View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19494_high_38 (Length: 215)
Name: NF19494_high_38
Description: NF19494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19494_high_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 20 - 198
Target Start/End: Complemental strand, 46935230 - 46935054
Alignment:
| Q |
20 |
aaatacaaactagggggtgatgcatttctctaagagtggtgttattggaacatcaaaacgttgcattgtatttgaacactgtacaaaaatacatacatca |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||| |||||| |
|
|
| T |
46935230 |
aaatactaactagggggtgatgcatttctctaagagtggtgttattggaacatcaaaatgttgcattatatttgaacacagtacaaaaat----acatca |
46935135 |
T |
 |
| Q |
120 |
tttataactactaattttgttattaggaagg--gagagaggggtaaatacaaacagcattattgtataccaacccgcatac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46935134 |
tttataactactaattttgttattaggaagggagagagaggggtaaatacaaacagcattattgtataccatcccgcatac |
46935054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University