View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19494_low_17 (Length: 326)
Name: NF19494_low_17
Description: NF19494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19494_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 22 - 304
Target Start/End: Complemental strand, 20520116 - 20519834
Alignment:
| Q |
22 |
ccgaatcaggttacggttgtttgtgtgctttcggcttgtggtcatggtggtatgcttcagcttgggaaatggatacatggttatgtttatagacatgggt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20520116 |
ccgaatcaggttacggttgtttgtgtgctttcagcttgtggtcatggtggtatgcttcagcttgggaaatggatacatggttatgtttatagacatgggt |
20520017 |
T |
|
| Q |
122 |
ttgtagttgattcgtttgtgtcgaatgcgcttgtggatatgtatgggaagtgtgggagtttggaggtggcgaggaaggtttttgagatggatcaacgtaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20520016 |
ttgtagttgattcgtttgtgtcgaatgcgcttgtggatatgtatgggaagtgtgggagtttggagttggcgaggaaggtttttgagatggatcaacgtaa |
20519917 |
T |
|
| Q |
222 |
ggggttgacttcatggaattcgatgattaattgttatgcgttgcatgggaaatgtgaggatgcgattgcgttttttgagaaga |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20519916 |
ggggttgacttcatggaattcgatgattaattgttatgcgttgcatgggaaatgtgaggatgcgattacgttttttgagaaga |
20519834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University