View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19494_low_18 (Length: 314)
Name: NF19494_low_18
Description: NF19494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19494_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 101 - 303
Target Start/End: Original strand, 36026431 - 36026635
Alignment:
| Q |
101 |
gcagttaagttcattttgaaaaatcagggctcgttctgaatat--gatgatgccatttttcaaccccagttggataagtatgaaacttgtctggatacat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36026431 |
gcagttaagttcattttgaaaaatcagggctcgttctgaatatatgatgatgccatttttcaaccccagttggataagtatgaaacttgtctggatacat |
36026530 |
T |
|
| Q |
199 |
agcctgtttaatttctgtttttgtatttgtaagnnnnnnngttctcttgtagatcgctattgcctccagacatgtgtcctcctcaacatctcattctagt |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36026531 |
agcctgtttaatttctgtttttgtatttgtaagtttttttgttctcttgtagatcgctattgcctccagacatgtgtcctcctcaacatctcattctagt |
36026630 |
T |
|
| Q |
299 |
atatt |
303 |
Q |
| |
|
||||| |
|
|
| T |
36026631 |
atatt |
36026635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 36026331 - 36026369
Alignment:
| Q |
1 |
cacttccctattggatcatccaaccttatccttacctgg |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36026331 |
cacttccctattggatcatccaaccttatccttacctgg |
36026369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 108 - 293
Target Start/End: Complemental strand, 16933951 - 16933766
Alignment:
| Q |
108 |
agttcattttgaaaaatcagggctcgttctgaatatgat---------gatgccatttttcaaccccagttggataagtatgaaacttgtctggatacat |
198 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||||||||||| | |||||||||||| || |||||||||| ||| ||| |||||||||| ||| |
|
|
| T |
16933951 |
agttcattttgaaaaaccagtgcttgttctgaatatgatatatgatatgctgccatttttcagccatagttggataactattaaatttgtctggattcat |
16933852 |
T |
|
| Q |
199 |
agcctgtttaatttctgtttttgtatttgtaagnnnnnnngttctcttgtagatcgctattgcctccagacatgtgtcctcctcaacatctcatt |
293 |
Q |
| |
|
||||||||| |||| ||||||||||| | |||||||||||| | ||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
16933851 |
agcctgttttattttcttttttgtattttt---------tgttctcttgtaggtagctattgcctccaaacatgtgtcctcctcaacctctcatt |
16933766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University