View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19494_low_25 (Length: 283)
Name: NF19494_low_25
Description: NF19494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19494_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 9 - 265
Target Start/End: Complemental strand, 36256450 - 36256194
Alignment:
| Q |
9 |
aaaatttgtttcatatgcaagacaaaacaattttatatagcagtgagttgcatcaaatgtttccaaagaagggtccatctagcatgatctagtatatcat |
108 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
36256450 |
aaaatttgtttcaaatgcaagacaaaacaattttatatagcagtgagttgcatcaaatgttttcatagaagggtccatctagcatgatctagtatatcat |
36256351 |
T |
 |
| Q |
109 |
tttgatcatgggggtctagttagctacaacccatatgatcaagtaggttatttcatattatcatggactcacggttcatcgatactagattccacatctt |
208 |
Q |
| |
|
||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36256350 |
tttgaccattgggatctagttagctacaacccatatgatcaagtaggttatttcatattatcatggactcacggttcatcgatactagattccacatctt |
36256251 |
T |
 |
| Q |
209 |
gtctctctcatccttcttcatgttcatatcaacacaaacgctgcacacttctataat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36256250 |
gtctctctcatccttcttcatgttcatatcaacacaaacgctgcacacttctataat |
36256194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University