View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19494_low_28 (Length: 261)
Name: NF19494_low_28
Description: NF19494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19494_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 48 - 189
Target Start/End: Original strand, 39460982 - 39461123
Alignment:
| Q |
48 |
caatgtcaggtttgcaacacataggtcgatgatgaatgaggaaaatatcgaattcaataacgactatgtgtgacagatttgacattgcgaaaaattcatt |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39460982 |
caatgtcaggtttgcaacacataggtcgatgatgaatgaggaaaatatcgaattcaataacgactatgtgtgacagatttgacattgccaaaaattcatt |
39461081 |
T |
|
| Q |
148 |
tgggatagtgcaaggctgacaaaaactttacagtggaagact |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39461082 |
tgggatagtgcaaggctgacaaaaactttacagtggaagact |
39461123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 196 - 224
Target Start/End: Original strand, 39461158 - 39461186
Alignment:
| Q |
196 |
aaaaatcgaagcttaaaaacccaattcac |
224 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39461158 |
aaaaatcgaagcttaaaaacccaattcac |
39461186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University