View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19494_low_32 (Length: 247)
Name: NF19494_low_32
Description: NF19494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19494_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 47741767 - 47741668
Alignment:
| Q |
1 |
tcagatttcaaatttttaacttataagaaataaataagtaatttaatttcttatcttatactttcaaattaaattcaggataatgattttagctagaaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47741767 |
tcagatttcaaatttttaacttataaggaataaataagtaatttaatttgttatcttatactttcaaattaaattcaggataatgattttaactagaaag |
47741668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 157 - 232
Target Start/End: Complemental strand, 47741560 - 47741485
Alignment:
| Q |
157 |
atatcagattatctcatcaaacattaaattgaaataaaatatgatagaattatattggctacctaatagaccatta |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47741560 |
atatcagattatctcatcaaacattaaattgaaataaaatatgatagaattatattggcaacctaatagaccatta |
47741485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 120 - 157
Target Start/End: Complemental strand, 47741648 - 47741611
Alignment:
| Q |
120 |
taaatatttagattcaagtggttaatgacgagaaccga |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47741648 |
taaatatttagattcaagtggttaatgacgagaaccga |
47741611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University