View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19494_low_40 (Length: 215)
Name: NF19494_low_40
Description: NF19494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19494_low_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 212
Target Start/End: Original strand, 27677129 - 27677328
Alignment:
| Q |
13 |
gggttcgacggtgttagtggttagtctcacatcgactatgaattaaatgtgttgagtatataagatgtaagacatatagacacatatgtttttatgattt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
27677129 |
gggttcgacggtgttagtggttagtctcacatcgactatgaattaaatgtgttgagtatataagatgtaagtcatatagacacatatatttttatgattt |
27677228 |
T |
|
| Q |
113 |
tggatgatgatataatatcaatagcccttggtagtcatgattgttagacccattgtttccccagctcaaatttgaagcttctatggcaattacaatcgat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27677229 |
tggatgatgatataatatcaatagcccttggtagtcatgattgttagacccattgtttccccagctcaaatttgaagcttctatggcaattacaatcgat |
27677328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University