View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19494_low_41 (Length: 215)

Name: NF19494_low_41
Description: NF19494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19494_low_41
NF19494_low_41
[»] chr3 (1 HSPs)
chr3 (20-198)||(46935054-46935230)


Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 20 - 198
Target Start/End: Complemental strand, 46935230 - 46935054
Alignment:
20 aaatacaaactagggggtgatgcatttctctaagagtggtgttattggaacatcaaaacgttgcattgtatttgaacactgtacaaaaatacatacatca 119  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||||||||    ||||||    
46935230 aaatactaactagggggtgatgcatttctctaagagtggtgttattggaacatcaaaatgttgcattatatttgaacacagtacaaaaat----acatca 46935135  T
120 tttataactactaattttgttattaggaagg--gagagaggggtaaatacaaacagcattattgtataccaacccgcatac 198  Q
    |||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||| |||||||||    
46935134 tttataactactaattttgttattaggaagggagagagaggggtaaatacaaacagcattattgtataccatcccgcatac 46935054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University