View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19494_low_42 (Length: 203)
Name: NF19494_low_42
Description: NF19494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19494_low_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 21 - 190
Target Start/End: Complemental strand, 29095867 - 29095697
Alignment:
| Q |
21 |
ctccttagccacctgattcgtcaaaccacaatcaatgtgtcaacgactgccaatttaatcatc-accctcaaccctagaggagaaaaataatgtcatctc |
119 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | |||||||||||| ||||||||||| ||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29095867 |
ctccttagccacctgatttgtcaaaccacaaactatgtgtcaacgagtgccaatttaaccatataccctcaaccctagaagagaaaaataatgtcatctc |
29095768 |
T |
|
| Q |
120 |
aacaatttttagagacattagggtctctttggtattatagaacattttctgttttcagttcatgttttcat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29095767 |
aacaatttttagagacattagggtctctttggtattatagaacattttctgttttcagttcatgttttcat |
29095697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University