View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19495_high_25 (Length: 284)
Name: NF19495_high_25
Description: NF19495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19495_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 1984696 - 1984970
Alignment:
| Q |
1 |
ttcttttgagagtttaacaagtgctcaataggttgttttacaagtttgatacctggaaggtttgttatgttttcccaaggtaattttttaaggactttta |
100 |
Q |
| |
|
|||||||||| |||||| |||| |||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1984696 |
ttcttttgagtgtttaaaaagtattcaataggttgttttacaagtttgattcctggaaggttggttatgttttcccaaggtaactttttaaggactttta |
1984795 |
T |
 |
| Q |
101 |
gaggtgcagatataagtacctttttaattccatgcaaaggccctttgattagctttgaaagaaatttccaaagtatactc-aaaatttcttaacatggat |
199 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1984796 |
gaggtgcagatataagtacctttttgattccatgcaaaggccctttgattatctttgaaagaaatttccaaagtatactcaaaaatttcttaacatggat |
1984895 |
T |
 |
| Q |
200 |
ggaatcattagttgatgaattttcatctccttcttgttgatccacttcttgttgaatctcaacttcgatgatgtc |
274 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1984896 |
ggaatcattagttgatgatttttcatctccttcttgttgatccacttcttgttgaatctcaacttcaatgatgtc |
1984970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University