View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19495_low_12 (Length: 397)
Name: NF19495_low_12
Description: NF19495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19495_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 300; Significance: 1e-168; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 20 - 323
Target Start/End: Original strand, 41573858 - 41574161
Alignment:
| Q |
20 |
aaggtgagggtctgcgatggcaacaacagcaacattttcgttgcaaagatggtgtaaattaataagatgttctcttcccatcattccaactcctattatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41573858 |
aaggtgagggtctgcgatggcaacaacagcaacattttcgttgcaaagatggtgtaaattaataagatgttctcttcccatcattccaactcctattatt |
41573957 |
T |
 |
| Q |
120 |
ccatactttactactactgttgcagtggccatggattttgaatttgattttgattcttctattaattcactcactcactctttaagcttcaacttcatag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41573958 |
ccatactttactactactgttgcagtggccatggattttgaatttgattttgattcttctattaattcactcactcactctttaagcttcaacttcatag |
41574057 |
T |
 |
| Q |
220 |
gtcttggtttctcaaataatatccgaatgaatttcacttcatactctgtttgttcggtatcagacaacatccacgtctgcaaacatcatagttactcgat |
319 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41574058 |
gttttggtttctcaaataatatccgaatgaatttcacttcatactctgtttgttcggtatcagacaacatccacgtctgcaaacatcatagttactcgat |
41574157 |
T |
 |
| Q |
320 |
tttt |
323 |
Q |
| |
|
|||| |
|
|
| T |
41574158 |
tttt |
41574161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 322 - 397
Target Start/End: Original strand, 41574191 - 41574266
Alignment:
| Q |
322 |
ttggaggaatttgtgtttaagattgacattnnnnnnntttatttatttaatatttattgtaatgcttttctttttt |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41574191 |
ttggaggaatttgtgtttaagattgacattaaaaaaaattatttatttaatatttattgtaatgcttttctttttt |
41574266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University