View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19495_low_24 (Length: 292)
Name: NF19495_low_24
Description: NF19495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19495_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 27 - 136
Target Start/End: Original strand, 36902876 - 36902985
Alignment:
| Q |
27 |
agagaagagagaaaaatctcatattcttagcaatacttttcgtattttgactaattctagtcgcttacaatatagaaatgactaaatgatttaagcatgc |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
36902876 |
agagaagagagaaaaatctcatattcttagcaatacttttcgtatttagactaattctagtcgcttacaacatagaaatgactaaatgatttaaccatgc |
36902975 |
T |
 |
| Q |
127 |
atcagattct |
136 |
Q |
| |
|
|||||||||| |
|
|
| T |
36902976 |
atcagattct |
36902985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University