View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19495_low_29 (Length: 250)
Name: NF19495_low_29
Description: NF19495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19495_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 21 - 138
Target Start/End: Complemental strand, 55062478 - 55062361
Alignment:
| Q |
21 |
gtgaggcttgtcattttgtccttttatcaacttttgatttattgatatagccattctaagacacacccacattaattagaatttcatttattttcttaaa |
120 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55062478 |
gtgaggcttgtcattttgtacttttatcaacttttgatttattgatatagccattctaagacacacccacattaattagaatttcatttattttcttaaa |
55062379 |
T |
 |
| Q |
121 |
gggtaaagattttacagg |
138 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
55062378 |
gggtaaagattttacagg |
55062361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 192 - 233
Target Start/End: Complemental strand, 55062305 - 55062264
Alignment:
| Q |
192 |
cagccgaactgatattaccgtgcttctctctatggccaggat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55062305 |
cagccgaactgatattaccgtgcttctctctatggccaggat |
55062264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University