View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19495_low_30 (Length: 248)
Name: NF19495_low_30
Description: NF19495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19495_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 137 - 236
Target Start/End: Original strand, 5242266 - 5242365
Alignment:
| Q |
137 |
aggccgatcaggtcctaacttccaaagcttgtgtttgcaaatttttgagcaattcacggagtctattgagcgatcatcttaaagcaataatatgaatatt |
236 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5242266 |
aggccgatcaggtcctaacttccaatgcttgtgtttgcaaatttttgagcaattcacggagtttattgagcgatcatcttaaagcaataatatgaatatt |
5242365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 5234379 - 5234461
Alignment:
| Q |
1 |
tttgttccctacttttatgaagtaagataattgctcaataggtctatcggagttgctcatcacattggatcgcaaatagacac |
83 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5234379 |
tttgttccctacttttacgaagtaagataattgctcaataggtctatcggagttgctcatcacattggatcgcaaatagacac |
5234461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University