View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19495_low_32 (Length: 245)
Name: NF19495_low_32
Description: NF19495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19495_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-125; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 40030135 - 40029906
Alignment:
| Q |
1 |
gaaaatttaccttatagattgataaggtaatttcaacttgctgtccattatacgtagatgaagttgaagatattggagctccaagtgtaattacgctatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40030135 |
gaaaatttaccttatagattgataaggtaatttcaacttgctgtccattatacgtagatgaagttgaagaaattggagctccaagtgtaattacgctatt |
40030036 |
T |
 |
| Q |
101 |
ggtatttggaacaaaaccgcacccaagattgtagcatccagtttgatatccatccttctgcaattattactattattttcttattaatgtgtatgttaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40030035 |
ggtatttggaacaaaaccgcacccaagattgtagcatccagtttgatatccatccttctgcaattattactattattttcttattaatgtgtatgttaga |
40029936 |
T |
 |
| Q |
201 |
aacaaatataaattaccttcacgtcagaaa |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40029935 |
aacaaatataaattaccttcacgtcagaaa |
40029906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 30927365 - 30927416
Alignment:
| Q |
7 |
ttaccttatagattgataaggtaatttcaacttgctgtccattatacgtaga |
58 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||| |||||||||||||||| |
|
|
| T |
30927365 |
ttaccttatagattaataaagtaatttcaatttgccgtccattatacgtaga |
30927416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University