View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19495_low_35 (Length: 238)
Name: NF19495_low_35
Description: NF19495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19495_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 4 - 224
Target Start/End: Complemental strand, 26842622 - 26842402
Alignment:
| Q |
4 |
tgaaaatattgccaaatgtacacacggtttctttgcatgcacgttagaaatttagaataaaacaatagatcatggtatatatttgaaggatagtgctttc |
103 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26842622 |
tgaaaatattgccaaatgtacacactgtttctttgcatgtacgttagaaatttagaataaaacaatagatcatggtatatatttgaaggatagtgctttc |
26842523 |
T |
 |
| Q |
104 |
aggatctatatcaagataacttctaaattgggtataagtcagattatcaaaacaaaaatcaacaccataaacaattgtgaaatcaatagccacttaatca |
203 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26842522 |
aggatctatatcaagataacttataaattggatataagtcagattatcaaaacaaaaatcaacaccataaacaattgtgaaatcaatagccacttaatca |
26842423 |
T |
 |
| Q |
204 |
aacaattataaactacaaaaa |
224 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
26842422 |
aacaattataaactacaaaaa |
26842402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University