View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19495_low_38 (Length: 235)
Name: NF19495_low_38
Description: NF19495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19495_low_38 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 10323951 - 10324188
Alignment:
| Q |
1 |
ctgttatatctctttttagtgtgccactattggcctttttagttctcatgcttctatttttaacaagagctctcatgctacttttgttttacaagagctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10323951 |
ctgttatatctctttttagtgtgccactattggcctttttagttctcatgcttctatttttaacaagagctctcatgcttcttttgttttacaagagctc |
10324050 |
T |
 |
| Q |
101 |
tcatgctactaa---atggtttatgaaagtgagtttatgttttatcnnnnnnnctcaatacacctcttacgtgaaatgcattatatggatgcatcaaacc |
197 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10324051 |
tcatgctactaaaatatggtttatgaaagtgagtttatgttttatctttttttctcaatacacctcttacgtgaaatgcattatatgcatgcatcaaacc |
10324150 |
T |
 |
| Q |
198 |
agccatatgaatgcacatcttgatttatgaattatgaa |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10324151 |
agccatatgaatgcacatcttgatttatgaattatgaa |
10324188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University