View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19495_low_39 (Length: 203)
Name: NF19495_low_39
Description: NF19495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19495_low_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 13 - 182
Target Start/End: Original strand, 39314181 - 39314350
Alignment:
| Q |
13 |
gaagaatataacataatcggtagtgtaggtgaggaaccacgaacgatccaatgatggtgtgatttaaactccagcatatgattaattcattgaatagaaa |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39314181 |
gaagaaaataacataatcggtagtgtaggtgaggaaccacgaacgatccaatgatggtgtgatttaaactccagcatatgattaattcattgaatagaaa |
39314280 |
T |
|
| Q |
113 |
tgactatgaatctgacaaaataagaaaaatgatagaagaagggcagggccggctaaggtcatcaccttag |
182 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39314281 |
tgactatgaatccgacaaaataagaaaaatgatagaagaagggcagagccggctaaggtcatcaccttag |
39314350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University