View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19499_high_7 (Length: 456)
Name: NF19499_high_7
Description: NF19499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19499_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 6e-41; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 126 - 267
Target Start/End: Complemental strand, 4020652 - 4020511
Alignment:
| Q |
126 |
ccacttagtgcagattagccctattcgctaaatccaaccaaatattttagatcctctcaaccaaaccctcttttgatcttctctgtctttctcttaatga |
225 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
4020652 |
ccacttagtgcagattatccctattcactaaatccaaccaaataatttagatcctctcaatcaaaccctcttttgatcttctctatctttctctgaatga |
4020553 |
T |
|
| Q |
226 |
aaaatggaaattttttagaaaactgaacaataatggtgacat |
267 |
Q |
| |
|
| | ||||| || ||||||||||||| ||||| ||||||| |
|
|
| T |
4020552 |
agagaggaaaattattagaaaactgaaatataattgtgacat |
4020511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 339 - 456
Target Start/End: Original strand, 3949555 - 3949670
Alignment:
| Q |
339 |
tgatttaaaggtttagacttcagatcatgtgactgcgtttaatgtgtgatttcttgacggcaagtaaaccgaaatttactcagaatgcattacacttatc |
438 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||| |||| |
|
|
| T |
3949555 |
tgattcaaaggtttagacttcagatcatgtgactgcgtttaatgtgtgatttcttgacgg--tgtaaaccgaaacttacttagaatgcattacttttata |
3949652 |
T |
|
| Q |
439 |
ttttatttacccaaacaa |
456 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3949653 |
ttttatttacccaaacaa |
3949670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 126 - 226
Target Start/End: Original strand, 3960667 - 3960762
Alignment:
| Q |
126 |
ccacttagtgcagattagccctattcgctaaatccaaccaaatattttagatcctctcaaccaaaccctcttttgatcttctctgtctttctcttaatga |
225 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||| |||||||||||| ||||| |||||||||||||| | ||||||||||||||| |
|
|
| T |
3960667 |
ccacttagttcagattagccctattcgctaaatccaacaaaa-----gagatcctctcaatcaaactctcttttgatcttccccatctttctcttaatga |
3960761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University