View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19499_low_26 (Length: 249)
Name: NF19499_low_26
Description: NF19499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19499_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 15 - 230
Target Start/End: Original strand, 41975612 - 41975822
Alignment:
| Q |
15 |
ttgaagctgcagaatggtaatttttcccataaacacaagtgtatatgaatttacttagctttgaggatcactaactcatcatcctctggaagcccctgat |
114 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41975612 |
ttgaagctgcagaatggtaattttgcccataaacacaagtgtatatgaatttactt-----tgaggatcactaactcatcctcctctggaagcccctgat |
41975706 |
T |
 |
| Q |
115 |
gaaagaggacttgtttgcaatctcatcatatctataaaccttctcttggaagttaggtatcacactgaaggcaaatgcttgatttcaaagcattaagatt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41975707 |
gaaagaggacttgtttgcaatctcatcatatctataaaccttctcttggaagtgaggtatcacactgaaggcaaatgcttgatttcaaagcattaagatt |
41975806 |
T |
 |
| Q |
215 |
tgtagagacacaaatc |
230 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
41975807 |
tgtagagacagaaatc |
41975822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 15 - 194
Target Start/End: Complemental strand, 1222639 - 1222465
Alignment:
| Q |
15 |
ttgaagctgcagaatggtaatttttcccataaacacaagtgtatatgaatttacttagctttgaggatcactaactcatcatcctctggaagcccctgat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1222639 |
ttgaagctgcagaatggtaatttttcccataaacacaagtgtatatgaatttactt-----tgaggatcactaactcatcatcctctggaagcccctgtt |
1222545 |
T |
 |
| Q |
115 |
gaaagaggacttgtttgcaatctcatcatatctataaaccttctcttggaagttaggtatcacactgaaggcaaatgctt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
1222544 |
gaaagaggacttgtttgcaatctcatcatatctataaaccttctcttggaagtgaggtatcacaccgaaggcaaatgctt |
1222465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University