View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19499_low_30 (Length: 236)
Name: NF19499_low_30
Description: NF19499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19499_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 222
Target Start/End: Original strand, 12118676 - 12118879
Alignment:
| Q |
19 |
aaaccattaagacatcaaggacaacaaaaatagagtgcacttattcggtaaaacatgggttaaattttcaatcaacacaagacctaccgtgtttttgata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
12118676 |
aaaccattaagacatcaaggacaacaaaaatagagtgcacttatccggtaaaacatgggttaaattttcaatcaacacaagatctactgtgtttttgata |
12118775 |
T |
 |
| Q |
119 |
tcactcacctataaccttaatgctcttgatgtacaagaagctaatgaaatcaatgcaagcatacggaaacagtaaaacttacaataatatcaggtccctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12118776 |
tcactcacctataaccttaatgctcttgatgtacaagaagctaatgaaatcaatgcaagcatacggaaacagtaaaacttacaaaaatatcaggtccctt |
12118875 |
T |
 |
| Q |
219 |
tgct |
222 |
Q |
| |
|
|||| |
|
|
| T |
12118876 |
tgct |
12118879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University