View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1949_high_18 (Length: 228)
Name: NF1949_high_18
Description: NF1949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1949_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 5 - 212
Target Start/End: Original strand, 35021673 - 35021880
Alignment:
| Q |
5 |
ccctcacctgaccgcatcaccaccgccatgcaaaatctcaaactcactcacctccgtctcgaagaacccgacccatccataatccgttctcttctctaca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021673 |
ccctcacctgaccgcatcaccaccgccatgcaaaatctcaaactcactcacctccgtctcgaagaacccgacccatccataatccgttctcttctctaca |
35021772 |
T |
|
| Q |
105 |
ccaacatctccctcttcctcacaatccccaactacctcgtcactcacatcgctactaaccgctccatcgcacgtgcatggatctacactcacgtgcttcc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021773 |
ccaacatctccctcttcctcacaatccccaactacctcgtcactcccatcgccactaaccgctccatcgcacgtgcatggatctacactcacgtgcttcc |
35021872 |
T |
|
| Q |
205 |
cttctacc |
212 |
Q |
| |
|
|||||||| |
|
|
| T |
35021873 |
cttctacc |
35021880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University