View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1949_high_20 (Length: 218)
Name: NF1949_high_20
Description: NF1949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1949_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 10 - 177
Target Start/End: Complemental strand, 27401603 - 27401436
Alignment:
| Q |
10 |
gaagaaaatgaatagagtagtggctgaggtactaaatagcgtcattgtcaaaatgggacacatttcagctccaatgaagaaaggtaaaattatgctttct |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27401603 |
gaagaaaatgaatagattagtggctgaggtactaaatagcgtcattgtcaaaatgggacacatttcagctccaatgaagaaaagtaaaattatgctttct |
27401504 |
T |
 |
| Q |
110 |
ctgttgtgatctgcaatgaggttagttaaggttatcattgtattattggaaaaaaggaatatagtgga |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27401503 |
ctgttgtgatctgcaatgaggttagttaaggttatcattgtataattggaaaaaaggaatatagtgga |
27401436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University