View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1949_high_5 (Length: 437)

Name: NF1949_high_5
Description: NF1949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1949_high_5
NF1949_high_5
[»] chr4 (2 HSPs)
chr4 (17-151)||(42418713-42418828)
chr4 (340-376)||(42419834-42419870)


Alignment Details
Target: chr4 (Bit Score: 64; Significance: 8e-28; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 17 - 151
Target Start/End: Original strand, 42418713 - 42418828
Alignment:
17 atatgaggacgaatttggattccgacagtgaggaggaatcacggcggagcaaggcggagcaaggcggtgactggagcaatacgcatacgttggttagctg 116  Q
    ||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||||||||||             
42418713 atatgaggacgaatttggattccgacagtgaggaggaatcac----------ggcggagcaaggcggtgactggagcaatacgcatacgtt--------- 42418793  T
117 ggttccaaataaaattgtttgattgtttcgaccat 151  Q
    ||||| |||||||||||||||||||||||||||||    
42418794 ggttcaaaataaaattgtttgattgtttcgaccat 42418828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 376
Target Start/End: Original strand, 42419834 - 42419870
Alignment:
340 catttattgattttgtaaaactaataattcgaggcaa 376  Q
    |||||||||||||||||||||||||||||||||||||    
42419834 catttattgattttgtaaaactaataattcgaggcaa 42419870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University