View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1949_low_15 (Length: 238)
Name: NF1949_low_15
Description: NF1949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1949_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 223
Target Start/End: Original strand, 3385522 - 3385726
Alignment:
| Q |
19 |
gtaggatcttctcctagttgagttgaaagtgatggacatggtttactatattcgaacaaagtatgccgattagcaatgggtccgagtattcattcattgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3385522 |
gtaggatcttctcctagttgagttgaaagtgatgaatatggtttactatattcgaacaaggtatgccgattagcaatgggtcagagtattcattcattgt |
3385621 |
T |
|
| Q |
119 |
ttgaatgttgatgagaagtttgagaatatagaccgtgatatcttaatcttgatttctagatcgttgaatgatgatgaattgttttaattccctccctccc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3385622 |
ttgaatgttgatgagaagtttgagaatatagaccgtgatatcttaatcttgatttctagatcgttgaatgatgatgaattgttttaattccctccctccc |
3385721 |
T |
|
| Q |
219 |
ctttg |
223 |
Q |
| |
|
||||| |
|
|
| T |
3385722 |
ctttg |
3385726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University