View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1949_low_8 (Length: 336)
Name: NF1949_low_8
Description: NF1949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1949_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 3e-79; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 4546968 - 4547129
Alignment:
| Q |
1 |
ctgatgatattgaaactgctttgagagaagcaaaggaggagattggattagacccttctcttgttactgttgttactcttctcgaaccctttcatactaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4546968 |
ctgatgatattgaaactgctttgagagaagcaaaggaggagattggattagacccttctcttgttactgttgttactcttctcgaaccctttcatactaa |
4547067 |
T |
|
| Q |
101 |
ggtgtactgttacttactttttattatctaccactaatctattaaatttgtccagtccaagt |
162 |
Q |
| |
|
||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4547068 |
ggtctactgctacttactttttattatctaccactaatctattaaatttctccagtccaagt |
4547129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 256 - 319
Target Start/End: Original strand, 4547305 - 4547368
Alignment:
| Q |
256 |
agatagagatttcgtatactaatcttttggcgatctagatttttagttcattaattttgcaaac |
319 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4547305 |
agatagagatgtcgtatactaatcttttggcgatctagatttttatttcattaattttgcaaac |
4547368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 194 - 224
Target Start/End: Original strand, 4547158 - 4547188
Alignment:
| Q |
194 |
gaccaaaccaacaaagggaaaacacattcga |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4547158 |
gaccaaaccaacaaagggaaaacacattcga |
4547188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University