View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19501_low_4 (Length: 314)
Name: NF19501_low_4
Description: NF19501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19501_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 16 - 162
Target Start/End: Original strand, 19897039 - 19897183
Alignment:
| Q |
16 |
gtttcttccttttggtgtctcatttgcagaattcatgcagtcgcggcagtaacatattggagtctctcttctgtaacggttattattatttctctcatta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19897039 |
gtttcttccttttggtgtctcatttgcagaattcatgcagtcgcggcagtaacatattggagtctctcttctgtaacggttattattatt--tctcatta |
19897136 |
T |
|
| Q |
116 |
acgcctctttcgttgatgctgtgttaccacataaatggattacaaca |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19897137 |
acgcctctttcgttgatgctgtgttaccacataaatggattacaaca |
19897183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 247 - 292
Target Start/End: Original strand, 19897273 - 19897317
Alignment:
| Q |
247 |
gtcaaacacacaacactctttacggggattttgtctttccgttatg |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
19897273 |
gtcaaacacacaacactctttacggggatttt-tttttccgttatg |
19897317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University