View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19501_low_5 (Length: 250)
Name: NF19501_low_5
Description: NF19501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19501_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 81 - 234
Target Start/End: Original strand, 19897445 - 19897601
Alignment:
| Q |
81 |
gctttgaaatattaatgactagtgctagtgcttggaacggttctgatcggtttgannnnnnnnnnnnnngtt---ctgtttgtggctttcattttgcaat |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
19897445 |
gctttgaaatattaatgactagtgctagtgcttggaacggttctgatcggtttgattattatttttttttttttactgtttgtggctttcattttgcaat |
19897544 |
T |
 |
| Q |
178 |
ttagattgttcaattcaatttatgttgatagactatgattgtgttggtcggttattt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19897545 |
ttagattgttcaattcaatttatgttgatagactatgattgtgttggtcggttattt |
19897601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 9 - 50
Target Start/End: Original strand, 19897373 - 19897414
Alignment:
| Q |
9 |
aatcaattatatatgtggtcgttgatcttcatcgttctcatg |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19897373 |
aatcaattatatatgtggtcgttgatcttcatcgttctcatg |
19897414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University