View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19501_low_5 (Length: 250)

Name: NF19501_low_5
Description: NF19501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19501_low_5
NF19501_low_5
[»] chr7 (2 HSPs)
chr7 (81-234)||(19897445-19897601)
chr7 (9-50)||(19897373-19897414)


Alignment Details
Target: chr7 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 81 - 234
Target Start/End: Original strand, 19897445 - 19897601
Alignment:
81 gctttgaaatattaatgactagtgctagtgcttggaacggttctgatcggtttgannnnnnnnnnnnnngtt---ctgtttgtggctttcattttgcaat 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||               ||   |||||||||||||||||||||||||    
19897445 gctttgaaatattaatgactagtgctagtgcttggaacggttctgatcggtttgattattatttttttttttttactgtttgtggctttcattttgcaat 19897544  T
178 ttagattgttcaattcaatttatgttgatagactatgattgtgttggtcggttattt 234  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19897545 ttagattgttcaattcaatttatgttgatagactatgattgtgttggtcggttattt 19897601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 9 - 50
Target Start/End: Original strand, 19897373 - 19897414
Alignment:
9 aatcaattatatatgtggtcgttgatcttcatcgttctcatg 50  Q
    ||||||||||||||||||||||||||||||||||||||||||    
19897373 aatcaattatatatgtggtcgttgatcttcatcgttctcatg 19897414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University