View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19503_low_10 (Length: 277)
Name: NF19503_low_10
Description: NF19503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19503_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 2254561 - 2254822
Alignment:
| Q |
1 |
agaaagataaaaaatgtttattggaaaggcaacgaatgagggaaacttgaagaaatggaagagtaacggaaaattgcatactcatgtacacaataagatc |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2254561 |
agaaagataaaaaatgttttatggaaaggcaacaaatgagggaaacttgaagaaatggaagagtaacggaaaattgcatactcatgtacacaataagatc |
2254660 |
T |
 |
| Q |
101 |
atgagtagttgcaaaaaataaatcatgattgaggtaatctgccaacatggtagatgggggatgtgatggctatctttgagagtaacaggataaaaaggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2254661 |
atgagtagttgcaaaaaataaatcatgattgaggtaatctgccaacatggtagatgggggatgtgatggctatctttgagagtaacaggataaaaaggaa |
2254760 |
T |
 |
| Q |
201 |
gggcatgagtggggaaggggtgaggacggaatgagtgtgctactaggtgtgaggttactagt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2254761 |
gggcatgagtggggaaggggtgaggacggaatgagtgtgctactaggtgtgaggttactagt |
2254822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University