View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19503_low_11 (Length: 258)
Name: NF19503_low_11
Description: NF19503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19503_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 76 - 242
Target Start/End: Original strand, 37179248 - 37179413
Alignment:
| Q |
76 |
aggaagtatagacttgtggatataattgggg-ttttatttgtgtgtattaaattagatatgtagtgtgtatagaaattaggattaattctggctgtatgc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
37179248 |
aggaagtatagacttgtggatataattgggggttttatttgagtgtattaaattagatatgtagtgtgtatagaaattaggattaatt--ggctgtatac |
37179345 |
T |
 |
| Q |
175 |
attgtttgttgttatattctgcaagttttaattgtttgcatctacgtgaaaggggttcaagctctact |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
37179346 |
attgtttgttgttatattctgcaagttttaattgtttgcatttatctgaaaggggttcaagctctact |
37179413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University