View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19503_low_5 (Length: 400)
Name: NF19503_low_5
Description: NF19503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19503_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 1e-78; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 6823692 - 6823918
Alignment:
| Q |
15 |
atcaacaacgctctctctccgttctcaaagctcatgactaccgccgtcaaatctcccttctcaccggtgtcgaccttcctttaggcggaaccggccgccc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6823692 |
atcaacaacgctctctctccgttctcaaagctcatgactaccgccgtcaaatctcccttctcaccggtgtcgaccttcctttaggcggcaccggccgccc |
6823791 |
T |
|
| Q |
115 |
tgattccgtcgggtaactgttttgtttttctt-------------------agtctccgacaaaaaataatactcaaattagtctctgactcagtataac |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6823792 |
tgattccgtcgggtaactgttttgtttttcttagtccccaaacatcaattcagtctccgacaaaaaataatactcaaattagtctctgactcagtataac |
6823891 |
T |
|
| Q |
196 |
atagggaagagactatcgttgatttag |
222 |
Q |
| |
|
|||||||||| | ||| |||||||||| |
|
|
| T |
6823892 |
atagggaagatattattgttgatttag |
6823918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 292 - 400
Target Start/End: Original strand, 6823977 - 6824085
Alignment:
| Q |
292 |
aggctttattatgccaaaattggaattggaactccgtcaaaggattattatttgcaagtggatactggaactgatatgatattggttaattgtattcaat |
391 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
6823977 |
aggctttattatgcgaaaattggaattggaactccgtcaaaggattattatttgcaagtggatactggaactgatatgatgtgggttaattgtattcaat |
6824076 |
T |
|
| Q |
392 |
gcaaagagt |
400 |
Q |
| |
|
||||||||| |
|
|
| T |
6824077 |
gcaaagagt |
6824085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 144 - 182
Target Start/End: Complemental strand, 15835972 - 15835934
Alignment:
| Q |
144 |
cttagtctccgacaaaaaataatactcaaattagtctct |
182 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15835972 |
cttagtccccgacaaaaaataatactcaaattagtctct |
15835934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 160 - 196
Target Start/End: Complemental strand, 39902901 - 39902865
Alignment:
| Q |
160 |
aaataatactcaaattagtctctgactcagtataaca |
196 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
39902901 |
aaatagtactcaaattagtctctgactcattataaca |
39902865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University