View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19504_high_4 (Length: 236)
Name: NF19504_high_4
Description: NF19504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19504_high_4 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 39931687 - 39931469
Alignment:
| Q |
18 |
gatttctgattgttgcatcaatggtagtcgaggctttggttcctctgcttgagtatgatcggcaaggtgccaatgaagattattcagcttcatttggcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39931687 |
gatttctgattgttgcatcaatggtagtcgaggctttggttcctctgcttgagtatgatcggcaaggtaccaatgaagattattcagcttcatttggcaa |
39931588 |
T |
 |
| Q |
118 |
tgaagccaaggagcaagggaatcataaagtccattgctccaccaagggtaacttgcagactagggaattttggacagatgggctaatttgtgcttttgag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
39931587 |
tgaagccaaggagcaagggaatcataaagtccattgctccaccaaggataacttgcagactagggaattttggactgatgggcttatttgtgcttttgag |
39931488 |
T |
 |
| Q |
218 |
ttcatccgcgggtcacgga |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39931487 |
ttcatccgcgggtcacgga |
39931469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University