View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19504_high_4 (Length: 236)

Name: NF19504_high_4
Description: NF19504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19504_high_4
NF19504_high_4
[»] chr5 (1 HSPs)
chr5 (18-236)||(39931469-39931687)


Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 39931687 - 39931469
Alignment:
18 gatttctgattgttgcatcaatggtagtcgaggctttggttcctctgcttgagtatgatcggcaaggtgccaatgaagattattcagcttcatttggcaa 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
39931687 gatttctgattgttgcatcaatggtagtcgaggctttggttcctctgcttgagtatgatcggcaaggtaccaatgaagattattcagcttcatttggcaa 39931588  T
118 tgaagccaaggagcaagggaatcataaagtccattgctccaccaagggtaacttgcagactagggaattttggacagatgggctaatttgtgcttttgag 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |||||||||||||||    
39931587 tgaagccaaggagcaagggaatcataaagtccattgctccaccaaggataacttgcagactagggaattttggactgatgggcttatttgtgcttttgag 39931488  T
218 ttcatccgcgggtcacgga 236  Q
    |||||||||||||||||||    
39931487 ttcatccgcgggtcacgga 39931469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University