View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19504_low_2 (Length: 407)
Name: NF19504_low_2
Description: NF19504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19504_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 4e-60; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 197 - 396
Target Start/End: Complemental strand, 1139842 - 1139629
Alignment:
| Q |
197 |
tatgccaattttgtaggttattttttcattctagattagtttcttttcacaaattattgtggttctatttatctttttgtagtttaatg----------- |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1139842 |
tatgccaattttgtaggttattttttcattctaaattagtttcttttcacaaattattgtggttctatttatctttttgtagtttaatgatctgtttttt |
1139743 |
T |
 |
| Q |
286 |
-------ttctgttatatattcttcaattatatatatacgattaacaatttcaaaattggtatgaatcttcattgtcatttgggattctcttttgaattt |
378 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
1139742 |
tttctctttctgttatattttcttcaat----tatatacgattaacaatttcaaaattgatatgaatcttcattgtcatttgagattttcttttgaattt |
1139647 |
T |
 |
| Q |
379 |
taagatgattttattcat |
396 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
1139646 |
taagattattttattcat |
1139629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 17 - 57
Target Start/End: Complemental strand, 1140392 - 1140352
Alignment:
| Q |
17 |
agcatggattcacgagggcaaaaacaggaattaacaggaaa |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1140392 |
agcatggattcacgagggcaaaaacaggaattaacaggaaa |
1140352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 80 - 108
Target Start/End: Complemental strand, 1139955 - 1139927
Alignment:
| Q |
80 |
aagagtgaaggcattaacgtgagtatggg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1139955 |
aagagtgaaggcattaacgtgagtatggg |
1139927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 54 - 86
Target Start/End: Complemental strand, 1140272 - 1140240
Alignment:
| Q |
54 |
gaaaagaaaccgtccattaaatcgtcaagagtg |
86 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
1140272 |
gaaaagaaaccgtccattaaatcgtgaagagtg |
1140240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University