View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19505_high_17 (Length: 298)
Name: NF19505_high_17
Description: NF19505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19505_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 16 - 280
Target Start/End: Original strand, 44166469 - 44166733
Alignment:
| Q |
16 |
atagttaggcacttaattggacctttatgcccttccaaaacactcaaacaacaatactctctaagaacattattagtattacctcgccaaattcgaattg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44166469 |
atagttaggcacttaattggacctttatgcccttccaaaacactcaaacaacaatactctctaagaacattattagtattacctcgccaaattcgaattg |
44166568 |
T |
|
| Q |
116 |
tcttatcctcagaaccactgcacaccaaatcagataccacagccaaacacaatatagactttgtgtgaccacgtagagcacctatgactatcaaattacc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44166569 |
tcttatcctcagaaccactgcacaccaaatcagaaaccacagccaaacacaatatagactttgtgtgaccacgtagagcacctatgactatcaaattacc |
44166668 |
T |
|
| Q |
216 |
attttcacctttttcagataccaatattgatctatcacatgcaccggaatacaaaaccgaaccgt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44166669 |
attttcacctttttcagataccaatattgatctatcacatgcaccggaatacaaaaccgaaccgt |
44166733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University