View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19505_high_18 (Length: 257)
Name: NF19505_high_18
Description: NF19505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19505_high_18 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 24 - 257
Target Start/End: Complemental strand, 51487727 - 51487494
Alignment:
| Q |
24 |
gcaattcccacattttgcaaaacatgctgcattaaatttaagggcaacatataatctcatcatcatgcattcggaaattaatcgcatctgccggtaaact |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51487727 |
gcaattcccacattttgcaaaacatgctgcattaaatttaagggcaacatagaatctcatcatcatgcattcggaaattaatcgcatctgccggtaaact |
51487628 |
T |
 |
| Q |
124 |
tgaatcaaaccaagaatttgatgtgagcatgaactagcatctaggtatacgagttagggacacttaaatacacagcattacaaaacaagtcggtaaataa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51487627 |
tgaatcaaaccaagaatttgatgtgagcatgaactagcatctaggtatacgagttagggacacttaaatacacagcattacaaaacaagtcggtaaataa |
51487528 |
T |
 |
| Q |
224 |
tgtttcagatgtaccaaatcaaggaccgccagat |
257 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| |
|
|
| T |
51487527 |
tgtttcagatgtcccaaatcaaggtgcgccagat |
51487494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University