View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19505_high_31 (Length: 227)
Name: NF19505_high_31
Description: NF19505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19505_high_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 10760977 - 10760757
Alignment:
| Q |
1 |
cggttttcttcgccttgctggtttctgtgatgaaataagctcaggccttgctatggagggaaatattttcttgccttcaacttgaatagagactttaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760977 |
cggttttcttcgccttgctggtttctgtgatgaaataagctcaggccttgctatggagggaaatattttcttgccttcaacttgaatagagactttaaca |
10760878 |
T |
|
| Q |
101 |
taagcttgactttgggattggacttgtgttaaaatgctgataggtgttttgcatcttataatctcttgagcaactgatagaacatcagatttaaataaga |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760877 |
taagcttggctttgggattggacttgtgttaatatgctgataggtgttttgcatcttattatctcttgagcaactgatagaacatcagatttaaataaga |
10760778 |
T |
|
| Q |
201 |
aattgggcttcgtgaaatccc |
221 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
10760777 |
aattcggcttcgtgaaatccc |
10760757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University