View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19505_low_13 (Length: 336)
Name: NF19505_low_13
Description: NF19505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19505_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 20 - 186
Target Start/End: Original strand, 5526019 - 5526187
Alignment:
| Q |
20 |
tgcatcacctacttcgtgtttattttagcttggccccattctctactttgtagagcaaacattaaaaaccatgtcccctcgta--ccctttggtggtctt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
5526019 |
tgcatcacctacttcgtgtttattttagcctggccccattctctactttgtagagcaaacattaaaaaccatgtcccctcgtacccccttgggtggtctt |
5526118 |
T |
|
| Q |
118 |
gtaatctgaaagttaagttttgattgccttggcttattgtccaaggacttatgagtgacataaagtagt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5526119 |
gtaatctgaaagttaagttttgattgccttggcttattgtccaaggacttatgagtgacataaagtagt |
5526187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 183 - 322
Target Start/End: Original strand, 5526879 - 5527018
Alignment:
| Q |
183 |
tagtgattttagtgcatgttcactagatttgctaaaataatgaagatcatagtgatttcagcaaatccaccatcaataatctggaaaatgtaaatattta |
282 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5526879 |
tagtaattttagtgcatgttcactagatttgctaaaataacgaagatcatagtgatttcagcaaatccaccatcaataatctggaaaatgtaaatattta |
5526978 |
T |
|
| Q |
283 |
taattcattatatttcgttgtttcacattgattatctata |
322 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
5526979 |
taattcattagatttcgttgtttcacattcattatctata |
5527018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University