View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19505_low_15 (Length: 324)
Name: NF19505_low_15
Description: NF19505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19505_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 21 - 308
Target Start/End: Complemental strand, 1179327 - 1179029
Alignment:
| Q |
21 |
gatagatgatgcttcaaggtcaattagttgaacatgaaccaatttaatttggtcccagagaatgttgtgcaggttattttccccatgaattttaataaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1179327 |
gatagatgatgcttcaaggtcaattagttgaacatgaaccaatttaatttggtcccagagaatgttgtgcaggttattttccccatgaattttaataaaa |
1179228 |
T |
|
| Q |
121 |
ttccaaaatgatttctgaatatgaaaattgttgatcacactagtctttctgagatcatttcgcag-----------tcatctaatgatcgagaattttca |
209 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1179227 |
ttccaaaatgatttctgaataagaaaattcttgatcacactagtctttctgagatcatttcgcaggctaaattaactcatctaatgatcgagaattttca |
1179128 |
T |
|
| Q |
210 |
acttcattgattttgaagatcagattccttaacccctaacaatttcatgcattaaaacatgattcattcatgagtagaatctaccacataggtgataat |
308 |
Q |
| |
|
| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1179127 |
atttcattgattttgtagatcagattccttaacccctaacaatttcatgcattaaaacatgattcattcatgagtagaatctaccacataggtgataat |
1179029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 122 - 168
Target Start/End: Original strand, 35029201 - 35029247
Alignment:
| Q |
122 |
tccaaaatgatttctgaatatgaaaattgttgatcacactagtcttt |
168 |
Q |
| |
|
|||||||||| || |||||||||||||| | |||||||||||||||| |
|
|
| T |
35029201 |
tccaaaatgacttttgaatatgaaaattctcgatcacactagtcttt |
35029247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University