View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19505_low_20 (Length: 253)
Name: NF19505_low_20
Description: NF19505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19505_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 16 - 233
Target Start/End: Complemental strand, 6916378 - 6916164
Alignment:
| Q |
16 |
atgtcataattggttaggtttgagtatattgttagctcaagaccctaagttaatgtgaaaacaggnnnnnnnttatttgatgggttgtagggtgatgatt |
115 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6916378 |
atgtcataattagttagctttgagtatattgttagctcaagatcctaagttaatgtgaaaacaggaaaaaa-ttatttgatgggttgtagggtgatgatt |
6916280 |
T |
|
| Q |
116 |
ttgaaggtttactctgtgtgttgtagtagataatgtattgaaacaaggaagtaaaattaagatcaaatacagatggtgtgacatgtgaatgtagaaatga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6916279 |
ttgaaggtttactctgtgtgttgtagtagataatgtattgaaacaaggaagtaaaattaagatcaaatacagatggtgtgacatgtgaatgtagaaatga |
6916180 |
T |
|
| Q |
216 |
aacacaaagatatgaact |
233 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
6916179 |
aacac--agatatgaact |
6916164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University